Man Sentenced to Death for Torturing, Murdering His Pregnant Wife and Killing Her Unborn Baby

A crime story out of India this week serves as a reminder of how often pregnant women and unborn babies are subjected to cruel abuses.

The Times of India reports a judge in the Tamil Nadu district of India sentenced a man to death Tuesday for murdering his wife and unborn baby in 2015.

M. Suresh, 36, of Gandhi Nagar Colony, recently was convicted of murder and other crimes. Authorities said he abused his wife repeatedly, beating her and burning her with cigarettes.

On July 21, 2015, when his wife was about six months pregnant, authorities said Suresh accused her of having an affair. According to the report, he then punched her in the stomach and on other parts of her body, causing her to bleed.

The young woman and her unborn baby died in the hospital the next day, the report states.

The wife appears to have been very young. According to the report, they married when she was 14 years old, and she was pregnant with their third child when she was murdered.

Many women experience abuse during pregnancy and their unborn babies are often second, unrecognized victims. According to the March of Dimes, one in six abused women reports the first abuse occurred while she was pregnant.

Follow LifeNews on the Parler social media network for the latest pro-life news!

Several studies also have linked domestic violence to abortion. In these cases, some women were forced or pressured by partners into having abortions, while others believed having an abortion would help them escape abuse. A 2011 study in “Obstetrician and Gynaecologist” found that almost 40 percent of the women seeking abortions had a history of physical abuse and relationship issues.

Another study found that as many as 64 percent of post-abortive women say they felt pressured to have an abortion.

LifeNews has reported numerous crime stories involving pregnant women who allegedly were threatened, assaulted or killed after they refused to abort their unborn babies.

Man Sentenced to Death for Torturing, Murdering His Pregnant Wife and Killing Her Unborn Baby | LifeNews.com

Irish Government Admits: COVID-19 Does NOT Exist

After months of painstaking freedom of information law requests the government of Ireland has finally come clean and admitted that it has no scientific proof that the SARS-CoV-2 virus (COVID-19) exists. Which other nations are going to be next and admit this pandemic was a scam?

“AS PART OF OUR LEGAL ACTION we had been demanding the evidence that this virus actually exists [as well as] evidence that lockdowns actually have any impact on the spread of viruses; that face-masks are safe, and do deter the spread of viruses – They don’t. No such studies exist; that social distancing is based in science – It isn’t. it’s made up; that contact tracing has any bearing on the spread of a virus – of course it doesn’t. This organisation here – is making it up as they go along.” – Gemma O’Doherty

Originally streamed live from the office of Tony Holohan Chief Medical Officer of Ireland.

Irish Government Admits: COVID-19 Does NOT Exist | Principia Scientific Intl. (principia-scientific.com)

COVID19 – Evidence Of Global Fraud

COVID 19, and the subsequent governmental responses, appear to be part of an international conspiracy to commit fraud. It seems there is no evidence that a virus called SARS-CoV-2 causes a disease called COVID 19.

Sometimes you have to go with your gut. I am not an expert in genetics and, as ever, stand to be corrected. However my attention was drawn to some research published by the Spanish medical journal D-Salud-Discovery. Their advisory board of eminently qualified physicians and scientists lends further credibility to their research. Their claim is astounding.

The genetic primers and probes used in RT-PCR tests to identify SARS-CoV-2 do not target anything specific. I followed the search techniques outlined in this English translation of their report and can corroborate the accuracy of their claims about the nucleotide sequences listed in the World Health Organisations protocols. You can do the same.

D-Salud-Discovery state there are no tests capable of identifying SARS-CoV-2. Consequently, all claims about the alleged impact of COVID 19 on population health are groundless.

The entire official COVID 19 narrative is a deception. Ostensibly, there is no scientific foundation for any part of it.

If these claims are accurate we can state that there is no evidence of a pandemic, merely the illusion of one. We have suffered incalculable loss for no evident reason, other than the ambitions of unscrupulous despots who wish to transform the global economy and our society to suit their purposes.

In doing so this â€œparasite class” have potentially committed countless crimes. These crimes can and should be investigated and prosecuted in a court of law.

IDENTIFICATION OF WHAT EXACTLY?

The World Health Organisation (WHO) classified COVID-19 (COronaVIrus Disease 2019). They declared a global COVID 19 pandemic on March 11th 2019.

The WHO’s Laboratory testing guidance states:

The etiologic agent [causation for the disease] responsible for the cluster of pneumonia cases in Wuhan has been identified as a novel betacoronavirus, (in the same family as SARS-CoV and MERS-CoV) via next generation sequencing (NGS) from cultured virus or directly from samples received from several pneumonia patients.”

The WHO’s claim is that the SARS-CoV-2 virus causes the disease COVID-19. They also allege this virus has been clearly identified by researchers in Wuhan.

In the WHO’s Novel Coronavirus 2019-nCov Situation Report 1, they state:

The Chinese authorities identified a new type of coronavirus, which was isolated on 7 January 2020

On 12 January 2020, China shared the genetic sequence of the novel coronavirus for countries to use in developing specific diagnostic kits.”

These two statements from the WHO clearly suggest the SARS-CoV-2 virus was isolated (meaning purified for study) and then genetic sequences were identified from the isolated sample. From this, diagnostic kits were developed and distributed globally to test for the virus in towns, cities and communities around the world. According to the WHO and Chinese researchers, these tests will find the virus that causes COVID 19.

Yet the WHO also state:

Working directly from sequence information, the team developed a series of genetic amplification (PCR) assays used by laboratories.”

The Wuhan scientists developed their genetic amplification assays from â€œsequence information” because there was no isolated, purified sample of the so called SARS-CoV-2 virus. They also showed electron microscope images of the newly discovered virions (the spiky protein ball containing the viral RNA.)

However, such protein structures are not unique. They look just like other round vesicles, such as endocytic vesicles and exosomes.

Virologists claim that it is not possible to â€œisolate” a virus because they only replicate inside host cells. They add that Koch’s postulates do not apply because they relate to bacteria (which are living organisms). Instead, virologists observe the virus’ cytopathogenic effects (CPE), causing cell mutation and degradation, in cell cultures.

When Chinese researchers first sequenced the full SARS-CoV-2 genome they observed CPE in Vero E6 and Huh7 cells. Vero E6 are an immortalised monkey cell line and Huh7 are immortalised cancer (tumorigenic) cells. Meaning they have been maintained in vitro (in petri dish cultures) for many years.

Central to the official SARS-CoV-2 story is the idea that it is a zoonotic virus, capable of bridging the species gap from animals to humans. When scientists from the US CDC â€œinfected” various cells with the novel virus they noted the following:

We examined the capacity of SARS-CoV-2 to infect and replicate in several common primate and human cell lines, including human adenocarcinoma cells (A549) [lung celles], human liver cells (HUH7.0), and human embryonic kidney cells (HEK-293T), in addition to Vero E6 and Vero CCL81 [monkey cells]
No cytopathic effect was observed in any of the cell lines except in Vero cells [monkey cells]
HUH7.0 and 293T cells showed only modest viral replication and A549 cells [human lung tissue cells] were incompatible with SARS-CoV-2 infection.”

The CDC did not observe any CPE in human cells. They saw no evidence that this alleged virus caused any human illness. Nor did this supposed human virus show any notable replication in human cells, suggesting human to human infection would be impossible.

Noting this problem, a team of Polish scientists introduced this sequenced â€œvirus” to human epithethelium (airway) cells. They observed the effects on these HAE cultures for 5 days. They noted much greater replication than the CDC scientists but ultimately stated:

“We did not observe any release of the virus from the basolateral side of the HAE culture.”

Meaning they did not see any evidence of the supposed virions breaching the cell wall membrane. Again suggesting this so called virus isn’t infectious in human beings.

It is not clear that SARS-CoV-2 is a human virus capable of causing illness. It may not even physically exist. Is it nothing more than a concept based upon predictive genetic sequences?

VOYAGE OF DISCOVERY

The Wuhan Center for Disease Control and Prevention and the Shanghai Public Health Clinical Centre published the first full SARS-CoV-2 genome (MN908947.1 ). This has been updated many times. However, MN908947.1 was the first genetic sequence describing the alleged COVID 19 etiologic agent (SARS-CoV-2).

All subsequent claims, tests, treatments, statistics, vaccine development and resultant policies are based upon this sequence. If the tests for this novel virus don’t identify anything capable of causing illness in human beings, the whole COVID 19 narrative is nothing but a charade.

The WUHAN researchers stated that they had effectively pieced the SARS-CoV-2 genetic sequence together by matching fragments found in samples with other, previously discovered, genetic sequences. From the gathered material they found an 87.1% match with SARS coronavirus (SARS-Cov). They used de novo assembly and targeted PCR and found 29,891-base-pair which shared a 79.6% sequence match to SARS-CoV.

They had to use de novo assembly because they had no priori knowledge of the correct sequence or order of those fragments. Quite simply, the WHO’s statement that Chinese researchers isolated the virus on the 7th January is false.

The Wuhan team used 40 rounds of RT-qPCR amplification to match fragments of cDNA (complimentary DNA constructed from sampled RNA fragments) with the published SARS coronavirus genome (SARS-CoV). Unfortunately it isn’t clear how accurate the original SARS-CoV genome is either.

In 2003 a team of researchers from from Hong Kong studied 50 patients with severe acute respiratory syndrome (SARS). They took samples from 2 of these patients and developed a culture in fetal monkey liver cells.

They created 30 clones of the genetic material they found. Unable to find evidence of any other known virus, in just one of these cloned samples they found genetic sequences of â€œunknown origin.”

Examining these unknown RNA sequences they found 57% match to bovine coronavirus and murine hepatitis virus and deduced it was of the family Coronaviridae. Considering these sequences to suggest a newly discovered SARS-CoV virus (new discoveries being ambrosia for scientists), they designed RT-PCR primers to test for this novel virus. The researchers stated:

Primers for detecting the new virus were designed for RT-PCR detection of this human pneumonia-associated coronavirus genome in clinical samples. Of the 44 nasopharyngeal samples available from the 50 SARS patients, 22 had evidence of human pneumonia-associated coronavirus RNA.”

Half of the tested patients, who all had the same symptoms, tested positive for this new alleged virus. No one knows why the other half tested negative for this novel SARS-CoV virus. The question wasn’t asked.

This supposed virus had just a 57% sequence match to allegedly known coronavirus. The other 43% was just â€œthere.” Sequenced data was produced and recorded as a new genome as GenBank Accession No. AY274119.

The Wuhan researchers subsequently found an 79.6% sequence match to AY274119 and therefore called it a novel strain of SARS-CoV (2019-nCoV – eventually renamed SARS-CoV-2). No one, at any stage of this process, had produced any isolated, purified sample of any virus. All they had were percentage sequence matches to other percentage sequence matches.

ISOLATE NOTHING

Scientists are very annoyed because they keep saying the virus has been isolated but no one believes them. This is because, as yet, no one has provided a single purified sample of the SARS-CoV-2 virus. What we have instead is a completed genome and, as we are about to discover, it isn’t particularly convincing.

Investigative journalists Torsten Engelbrecht and Konstantin Demeter asked some of the scientists who said they had images of SARS-C0V-2 virions to confirm these were images of an isolated, purified, virus. None of them could.

In Australia scientists from the Doherty Institute, announced that they had isolated the SARS-CoV-2 virus. When asked to clarify the scientists said:

“We have short (RNA) sequences from the diagnostic test that can be used in the diagnostic tests”

This explains why the Australian government state:

The reliability of COVID-19 tests is uncertain due to the limited evidence base
There is limited evidence available to assess the accuracy and clinical utility of available COVID-19 tests.”

In The UK, in July, a group of concerned academics wrote a letter to the UK Prime Minister Boris Johnson in which they asked him to:

Produce independently peer reviewed scientific evidence proving that the Covid-19 virus has been isolated.”

To date they have not received a reply.

Similarly, UK researcher Andrew Johnson made a Freedom of Information Request to Public Health England (PHE). He asked them to provide him with their records describing the isolation of a SARS-COV-2 virus. To which they responded:

PHE can confirm it does not hold information in the way suggested by your request.”

Canadian researcher Christine Massey made a similar freedom of information request, asking the Canadian government the same. To which the Canadian government replied:

Having completed a thorough search, we regret to inform you that we were unable to locate any records responsive to your request.”

In the U.S. the Centre For Disease Control (CDC) RT-PCR Diagnostic Panel state:


No quantified virus isolates of the 2019-nCoV are currently available

..Detection of viral RNA may not indicate the presence of infectious virus or that 2019-nCoV is the causative agent for clinical symptoms.”

Last updated on 13th July 2020, the CDC are yet to obtain any pure viral sample from any patient said to have the disease of COVID-19. They openly admit their tests don’t necessarily show if SARS-CoV-2 is either present or causes COVID 19.

We are told that none of this matters. That we are ignorant and just don’t understand virology. Therefore, we must accept pictures of things we know could be something else and genetic sequences (which could be anything else) as conclusive proof that this virus, and the disease it is supposed to cause, are real.

TESTING FOR NOTHING

The WHO, and every government, think tank, policy steering committee, government scientific advisor, supranational institutions and others who promote the official COVID 19 narrative, assert that SARS-CoV-2 causes COVID 19.

While no one has ever produced a sample of this supposed virus, the alleged SARS-CoV-2 genome has been published. It is in the public domain.

Key genetic sequences, in the SARS-CoV-2 genome, are said to have specific functions. These are the target proteins that scientists test for to identify the presence of the â€œvirus”. These include:

  • RNA-polymerase (Rd-Rp) gene – This enables the SARS-CoV-2 RNA to replicate inside the cytoplasm of COVID 19 diseased epithelial cells.
  • S gene (Orf2) – this glycoprotein forms the spike on the SARS-CoV-2 virion surface which supposedly facilitates SARS-CoV-2 binding to the ACE2 receptors on cells, allowing the RNA inside the virion protein shell (capsid) to pass into the now infected cell.
  • E gene (Orf1ab) – small membrane protein used in viral assembly
  • N gene (Orf9a) – the nucleocapsid gene which binds the RNA in capsid formation

The WHO maintain a publicly available record of the RT-PCR primers and probes used to test for SARS-CoV-2. The primers are specific nucleotide sequences that bind (anneal) to the antisense and sense strands of the synthesised cDNA (called forward and reverse primers respectively.)

The cDNA strands separate when heated and reform when cooled. Prior to cooling, nucleotide sequences called probes are introduced to anneal to specific target regions of the suspected viral genome. During amplification, as the regions between primers elongate, when a primer strikes a probe, the probe decays releasing a fluorescent or dye which can then be read by researchers.

It is the identification of these markers which scientists claim to prove the presence of SARS-CoV-2 in a sample.

Something else which is publicly available is the Basic Local Alignment Search Tool (BLAST). This allows anyone to compare published nucleotide sequences with all those stored by the U.S. National Institutes of Health (NIH) genetic database called GenBank. Therefore we can BLAST the claimed SARS-CoV-2 primers, probes and target gene sequences.

The WHO’s forward, reverse primers and probe protocols, for the alleged SARS-CoV-2 viral genome, are based upon RdRp, Orf1, N and E gene profiles. Anyone can run them through BLAST to see what we find.

The vital RdRP nucleotide sequence, used as a forward primer is – ATGAGCTTAGTCCTGTTG. If we run a nucleotide BLAST this is recorded as a complete SARS-CoV-2 isolate with a 100% matched sequence identity. Similarly the reverse E gene primer sequence – ATATTGCAGCAGTACGCACACA – reveals the presence of the Orf1ab sequence which also identifies SARS-CoV-2.

However, BLAST also enables us to search the nucleotide sequences of the microbial and human genomes. If we search for the RdRp SARS-CoV-2 sequence it reveals 99 human chromosome with a 100% sequence identity match. The Orf1ab (E gene) returns 90 with a 100% sequence identity match to human chromosomes.

Doing the same for these sequences with a microbial search finds 92 microbes with a 100% match to the SARS-CoV-2 E gene and 100 matched microbes, with a 100% sequence identity, to the vital SARS-CoV-2 RdRp gene.

Whenever we check the so-called unique genetic markers for SARS-CoV-2, recorded in the WHO protocols, we find complete or high percentage matches with various fragments of the human genome. This suggests that the genetic sequences, which are supposed to identify SARS-CoV-2, are not unique. They could be anything from microbial sequences to fragments of human chromosomes.

So called fact checkers, like Reuters’ Health Feedback project, have been quick to dismiss the claims of those who have noticed the apparent lack of specificity in the supposed SARS-CoV-2 genome.

Using a slew of strawman arguments like, â€œthis claim suggests every test should be positive,” (which it doesn’t) their debunking attempt runs something like this:

Primers are designed to bind to specific nucleotide sequences that are unique to the virus. The forward primer may bind to a particular chromosome but the reverse primer doesn’t bind to the same chromosome and so the chromosome is not present in the SARS-CoV-2 virus. Moreover because the forward and perverse primers envelop the sequence to be amplified the cDMA sequence between primers is unique to the virus.

This seems to deliberately misrepresent the significance of these findings by forwarding an argument that no one, other than the fact checkers themselves, are making. BLAST searches show that these target sequences are not unique to SARS-CoV-2. Nor do all targets need to be found for a result to be deemed positive.

Moroccan researchers investigated the epidemiology of Moroccan alleged cases of SARS-CoV-2. Nine percent were positive for three genes, eighteen percent were positive for two genes and seventy three percent for just one. As we have just discussed, many may have been positive for none.

This is entirely in keeping with WHO’s test guidelines. They state:

“An optimal diagnosis consists of a NAAT [nucleic acid amplification test] with at least two genome-independent targets of the SARS-CoV-2; however, in areas where transmission is widespread, a simple single-target algorithm can be used

One or more negative results do not necessarily rule out the SARS-CoV-2 infection.”

Regardless of the spurious arguments of well funded fact checkers, if the forward and reverse primers identify junk, perhaps one being the fragment of a chromosome and the other a microbial sequence, then the amplified region between them is probably junk too.

The argument that RT-PCR only finds RNA is specious. Natural transcription (the separation of DNA strands) occurs during gene expression. No one is saying whole chromosomes or microbes are sequenced in the alleged SARS-CoV-2 genome. Though they may, for all we know. They are saying the alleged markers, used to test for this supposed virus, are not fit for purpose.

RT-PCR tests do not sequence the entire genome. They look for incidents of specific probe florescence to indicate the presence of sequences said to exist. These sequences are defined by MN908947.1 and the subsequent updates. These primers and probes could reveal nothing but RNA matches extracted from non-coding, sometimes called â€œjunk,” DNA (cDNA.)

For example the SARS-CoV-2 S gene is meant to be highly specific to the SARS-CoV-2 virus genome. The target sequence is – TTGGCAAAATTCAAGACTCACTTTC. A microbial BLAST search returns 97 microbial matches with 100% identity sequence match. The lowest identity percentage match, within the top 100, is 95%. A human genome BLAST also finds a 100% sequence match to 86 human chromosome fragments.

No matter where you look in the supposed genome of SARS-CoV-2, there is nothing in the WHO’s test protocols that clearly identifies what it is. The whole genome could be false. The tests do not prove the existence of SARS-CoV-2. All they reveal is a soup of unspecified genetic material.

If so, as there are no isolates or purified samples of the virus, without a viable test, there is no evidence that SARS-CoV-2 exists. Therefore, nor is there any evidence that a disease called COVID 19 exists.

This infers that there is no scientific basis for any claims about COVID 19 case numbers, hospital admissions or mortality figures. All measures taken to combat this deadly virus are quite possibly founded upon nothing.

CONCLUSIVE FRAUD

Fraud is a criminal act. The legal definition of fraud is:

“Some deceitful practice or willful device, resorted to with intent to deprive another of his right, or in some manner to do him an injury.”

The Legal definition of a conspiracy is:

“A combination or confederacy between two or more persons formed for the purpose of committing, by their joint efforts, some unlawful or criminal act”

It seems, those who claim we face a pandemic have not provided any evidence to show that a virus called SARS-CoV-2 causes a disease called COVID 19. All of the information strongly suggesting this possibility is readily available in the public domain. Anyone can read it.

For there to be a fraud the deceit must be wilful. The intention must be to deliberately deprive others of their rights or injure them in some other way. If there is evidence of collusion between individuals ad/or organisations to commit fraud, then this is a conspiracy (in Common Law jurisdictions) or a Joint Criminal Enterprise (JCE) under International Law.

It seems COVID 19 has been deliberately used as a casus belli to wage war on humanity. We have been imprisoned in our own homes, our freedom to roam restricted, freedom of speech and expression eroded, rights to protest curtailed, separated from loved ones, our businesses destroyed, psychologically bombarded, muzzled and terrorised.

Worse still, while there is no evidence of unprecedented all cause mortality, there were unseasonable spikes in deaths. These correlate precisely with Lockdown measures which saw the withdrawal of the health services we pay for and a reorientation of public health services to treat one alleged disease at the exclusion of all others.

Further, it is proposed by those who have forwarded the COVID 19 story, that this alleged disease provides justification for the complete restructuring of the global economy, our political systems, societies, cultures and humanity itself.

To be allowed to participate in their so called â€œnew normal,” which is the wholesale transformation of our entire society without our consent, they insist we submit to their conditions.

These include, but aren’t limited to, bio-metric surveillance of everyone, the centralised control and monitoring of all of our transactions, oppressive business and social restrictions and an effective demand that we have no right to sovereignty over our own bodies. This constitutes the condition of slavery.

There is no doubt that we have been deprived of our rights and injured. In Common Law jurisdictions innocence is presumed, but the evidence that harm has been deliberately caused by an international conspiracy is overwhelming. Destructive policies, enacted by governments across the world, clearly originated among globalist think tanks and supranational institutions long before the emergence of this non existent pandemic.

In Napoleonic Code jurisdictions, guilt is presumed. In order for the accused conspirators to prove their innocence they must show that, despite their immeasurable resources, they have collectively been unable to access or understand any of the freely available evidence suggesting COVID 19 is a myth.

Those responsible for the crime of conspiracy to commit global fraud should be tried. If found guilty they should be imprisoned while the rest of us get on with trying to repair the damage they have already inflicted.

COVID19 – Evidence Of Global Fraud – OffGuardian (off-guardian.org)

Kwanzaa Was Invented By An Insane Leftist Gangster Who Tortured Women

Today marks the first day of Kwanzaa, a week-long celebration for black Americans “to celebrate themselves and history” in the United States. Ironically, while many are familiar with the rich heritage and history of black Americans, few know anything about the horrifying and ridiculous heritage of Kwanzaa.

Kwanzaa began in 1966 when Los Angeles City College professor of Africana Studies, Ronald Everett, later re-styled Maulana Ndabezitha Karenga, launched an atheistic holiday specifically for black Americans. He derived the name from the Swahili phrase “matunda y kwanza,” which means “first fruits of the harvest.” Ironically, it is unlikely that any of the West African slaves transported to the Americas would have understood the East African phrase.

As any postmodern schoolboy knows, the seven principles of Kwanzaa are unity, self-determination, collective work, cooperative economics, purpose, creativity, and faith — not in God, but in “our people.” If those principles sound familiar, that’s because they were adopted in 1973 by the Symbionese Liberation Army, a left-wing terrorist group famous for the murders of a school superintendent and a 42-year-old mother of four in addition to kidnapping and raping 19-year-old heiress Patty Hearst.

Everett himself is no stranger to crime. In 1969 his black nationalist gang, “US,” murdered two Black Panthers during a turf war at UCLA. Two years later, Everett was sentenced to prison for felonious assault and false imprisonment after he tortured two women, Gail Davis and Deborah Jones. According to court testimony, Everett stripped the women naked, whipped them with electrical cords and karate batons, placed a hot soldering iron in Davis’ mouth and on her face, tightened Davis’ toes in a vise, put laundry detergent and running hoses in their mouths, and hit them on the head with toasters.

Despite the viciousness and extent of his crimes, Everett spent only four years in prison before a letter-writing campaign by his supporters led to a grant of parole in 1975. Helping the case for clemency was the conclusion of a psychiatrist who examined him in 1971 that Everett was insane, “both paranoid and schizophrenic.” The psychiatrist observed,

Since his admission here he has been isolated and has been exhibiting bizarre behavior, such as staring at the wall, talking to imaginary persons, claiming that he was attacked by dive-bombers and that his attorney was in the next cell. During part of the interview he would look around as if reacting to hallucination and when the examiner walked away for a moment he began a conversation with a blanket located on his bed. This man now presents a picture which can be considered both paranoid and schizophrenic with hallucinations and elusions, inappropriate affect, disorganization, and impaired contact with the environment.

Although virtually no one celebrates Everett’s invention, schoolchildren for decades have been taught the importance of Kwanzaa to the “holiday season.” That sly euphemism compares a decades-old, race-exclusive, vainglorious contrivance invented by an insane gangster who tortured women and inspired terrorists to “good news of great joy that will be for all the people.” Perhaps we ought to spend less time celebrating history and more time learning it.

Kwanzaa Was Invented By An Insane Leftist Gangster Who Tortured Women | The Daily Wire

Ontario (Canada) Admits Labelling Deaths As COVID When They’re Not A Result Of COVID-19

Ontario (Canada) Public Health has a page on their website titled “How Ontario is responding to COVID-19.” On it, they clearly state that deaths are being marked as COVID deaths and are being included in the COVID death count regardless of whether or not COVID actually contributed to or caused the death.

They state the following:

Any case marked as “Fatal” is included in the deaths data. Deaths are included whether or not COVID-19 was determined to be a contributing or underlying cause of death
”

This statement from Ontario Public Health echoes statements made multiple times by Canadian public health agencies and personnel. According to Ontario Ministry Health Senior Communications Advisor Anna Miller:

As a result of how data is recorded by health units into public health information databases, the ministry is not able to accurately separate how many people died directly because of COVID versus those who died with a COVID infection.

Again, this means when we observe the COVID-19 death count in Ontario, Canada, we are observing an inaccurate number given the fact that those who died with COVID may not have necessarily died as a result of it.

Theoretically if a person committed suicide and tested positive for COVID or died in a car crash, of a heart attack, of cancer, diabetes or any other illness, they are also included in the COVID death count. Let’s not forget the fact that a positive PCR test does not mean one has COVID.

This has been common theme during the span of this pandemic so far. For example, in late June Toronto (Ontario, Canada) Public Health tweeted that “Individuals who have died with COVID-19, but not as a result of COVID-19 are included in the case counts for COVID-19 deaths in Toronto.”

It’s not just in Canada where we’ve seen these types of statements being made, it’s all over the world. There are multiple examples from the United States that we’ve written about before.

For example, Dr. Ngozi Ezike, Director of the Illinois Department of Public Health stated the following during the first wave of the pandemic,

“If you were in hospice and had already been given a few weeks to live and then you were also found to have COVID, that would be counted as a COVID death, despite if you died of a clear alternative cause it’s still listed as a COVID death. So, everyone who is listed as a COVID death that doesn’t mean that was the cause of the death, but they had COVID at the time of death.”

During the first wave, the Colorado Department of Public Health and Environment had to announce a change to how it tallies coronavirus deaths due to complaints that it inflated the numbers.

The only issue is that we can’t know how many people have been added to the COVID death count in multiple places across the globe that did not actually die as a result of COVID. Theoretically, this could drive the global death count significantly lower than the official numbers we are getting.

At the end of the summer the CDC put out data showing that 94% of deaths that have been marked as COVID deaths had at least two or there other causes listed.

Out of all the deaths that have been labelled as a COVID-19 death in the United States up to the end of August, for 6% of them COVID-19 was the only cause mentioned and for 94% of the deaths there were other causes and conditions in addition to COVID-19.

The CDC states that “for deaths with conditions or causes in addition to COVID-19, on average, there were 2.6 additional conditions or causes per death.” So how do we know that COVID was the cause for many of these deaths or even contributed? Many believe COVID was the cause and even contributed to the comorbitities listed. You can view the updated numbers here in table 3 from the CDC as they are similar.

We also saw this very early on in Italy, where 99 percent of those who were marked as COVID deaths had multiple comorbidities.

With the last two examples it’s important to mention that COVID may have been the cause or even a contributing factor. We already know that people with comorbidities as well as the elderly are the most vulnerable.

We also know that for people 70 years and younger the survival rate of the virus is 99.95 percent, according to Dr. Jay Bhattacharya, MD,PhD, from the Stanford University School of Medicine.

This is why approximately 50,000 doctors and scientists have now signed The Great Barrington Declaration strongly opposing lockdown measures, citing information showing that they are doing more harm than good and explaining that we don’t have to lockdown everything to protect the vulnerable. There are, according to them, more proper and efficient ways of doing so.

Ontario (Canada) Admits Labelling Deaths As COVID When They’re Not A Result of COVID-19 (humansarefree.com)

Woman Sues Abortion Facility, Coerced Her Into Aborting Her Baby After She Spit Out Abortion Pills

Jessica Duran wavered back and forth about aborting her unborn baby as she sat inside a New Mexico abortion facility in 2012.

Though she eventually told the abortion workers to go through with the abortion, Duran said she still felt unsure; she even spit out the abortion pills that they gave her. But instead of encouraging her to take a few days to reconsider, Duran said the abortion staff coerced her into aborting her unborn child.

On Tuesday, the pro-life group Abortion on Trial shared Duran’s story and the medical records from her abortion at Southwestern Women’s Options in Albuquerque. Duran is suing the abortion facility in the case Duran vs. Curtis Boyd & S.W.O.

“I wanted my baby,” Duran said. “I didn’t just wake up one day and decide to go get an abortion. I fought for my child’s life for three months. I fought until I literally couldn’t physically or emotionally handle fighting that pressure anymore.”

Duran said her family and boyfriend wanted her to have an abortion. She said she considered it because she felt like she did not have any support.

According to Abortion on Trial, Duran expressed doubts during her first appointment at the abortion facility, and her medical records state that she decided to consider adoption for her baby.

However, she said her family was not supportive, so she scheduled an appointment for an abortion a few days later.

LifeNews depends on the support of readers like you to combat the pro-abortion media. Please donate now.

During that second appointment, her medical records indicate that Duran wavered about her decision multiple times – sometimes saying she was sure she wanted the abortion and other times indicating she was not.

At one point, her medical records say her mother who was in the waiting room asked to speak to her and Duran agreed. According to the records, Duran’s mother had changed her mind and did not want her daughter to abort her baby. The records indicate that the mother and daughter did speak together, but one of the abortion staffers eventually shut the door on the mother because “she was hounding” Duran.

“When Jessica was given misoprostol pills to begin her abortion procedure, she felt she could not go through with it. She spit the pills out and stated, ‘I can’t do this,’ as clearly documented in her chart,” according to Abortion on Trial.

Rather than encourage Duran to go home and take time to consider her options, her medical records say she was taken to a small room for “re-counseling” and then left alone. It is not clear how long she waited alone in the room.

Duran said she eventually broke down and agreed to go through with the surgical abortion. She was 13 weeks pregnant with her unborn baby, according to her records.

She said she refused pain medication because she wanted to feel the same pain her baby would feel – something Abortion on Trial pointed to as more evidence that the abortion facility should not have done the abortion.

On her medical records, the abortion facility claimed her abortion was “medically necessary” because the pregnancy had “a profound, negative impact upon the mental health of this woman.” Her unborn baby’s abortion death also was paid for by taxpayers through the state Medicaid program, according to the records.

Duran said she thought Southwestern Women’s Options had her best interests at heart, but she was wrong. She said she decided to share her story and sue the abortion facility to protect other women and babies from similar fates.

“Nobody loved my baby but me. I wish someone would’ve been there to tell me that my love was enough,” she said.

Jamie Jeffries, the director of Abortion on Trial, accused Southwestern Women’s Options of psychological malpractice.

“This provider should’ve sent Jessica home that day,” Jeffries said. “She was clearly not decided. And had they not taken her phone, prevented her from speaking to family, and shoved her in an isolating room, she probably would’ve found the strength to walk out with her baby alive.”

Jeffries said the abortion facility prioritized selling abortions over a patient’s well-being.

Abortion on Trial told LifeNews that it is involved in Duran’s legal case. A spokesperson said the trial was delayed due to COVID-19.

Woman Sues Abortion Facility, Coerced Her Into Aborting Her Baby After She Spit Out Abortion Pills | LifeNews.com

Black Misandry And Buck Breaking in the TV Show “Euphoria”

Tariq Nasheed đŸ‡ș🇾 on Twitter: “I’m watching this tv show called Euphoria & there was a scene where a Black male college student takes a white woman to his dorm room, and he starts having sex with her then out of nowhere, 8 white dudes wearing strap-ons storm into the room and rape the Black guy #BUCKBREAKING https://t.co/Dsqd3haJ2W” / Twitter

While McKay and Cassie were making out in his room, a very disturbing scene happened. McKay was attacked by eight naked/semi-naked frat guys who pushed him to the ground while McKay was naked and climbed on top of him while yelling “McGay!” and simulating sex acts.

It was left up to the viewers to figure out exactly what happened to McKay. He locked himself in the bathroom after they left and cried for a long time while Cassie was sitting on the bed. Then he insisted they have sex when he finally pulled himself together and left the bathroom.

Viewers aren’t sure what happened. Some think he was raped by those guys in the quick scene that a character also filmed while it was happening. Others think it was hazing and he was assaulted but not actually raped. I think the show purposefully left it vague so viewers could decide for themselves.

What Happened to McKay on Euphoria Episode 6? Top Theories | Heavy.com